the DNA of Shakespeare’s Sonnets
January 25, 2013 § Leave a comment
“TAGATGTGTACAGACTACGC…..” (Thou art more lovely and more temperate...)
An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.
I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.” Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.
So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.
This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).
Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.
Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.
The earliest forms of poetry also carried practical information—poems do things: Hesiod’s Works and Days; perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.
And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.
The Guardian article explains how the encoding takes place:
“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.
To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”
This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.
Then the DNA is stored in a dry, cool, dark place.
A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.
But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate. Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…” Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.
In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.
kim trainor 
Leave a Reply