the death of queen jane
April 15, 2014 § 6 Comments
Queen Jane lay in labour a full nine days or more
Til her women grew so tired they could no longer there.
Good women, good women, good women as ye be
Will you open my right side and find my baby.
Oh no cried the women, that’s a thing that can never be.
We will call on King Henry and hear what he may say.
King Henry was sent for, King Henry he did come,
Saying ‘What does ail you my Lady, your eyes they look so dim.’
‘King Henry, King Henry, will you do one thing for me,
Will you open my right side and find my baby.’
‘Oh no,’ cried King Henry, ‘that’s a thing that I can never do.
If I lose the flower of England I shall lose the branch too.’
There was fiddling and dancing on the day the babe was born
But poor Queen Jane beloved she lay cold as a stone.
The past few weeks I’ve been learning to play “The Death of Queen Jane,” a 16th century ballad I first heard sung by Oscar Isaac in the Coen brothers’ Inside Llewyn Davis. The tune used in the movie is a fairly recent one by Dáithí Sproule, composed in the 1970s and recorded by The Bothy Band in 1979, but the ballad itself, sung to different tunes, and transcribed in literary and vernacular variations I want to describe here, can be traced back to the late sixteenth century. What really draws me to this song is its depiction of a woman in labour, told at times from her perspective, in her voice, and its recording of a possible caesarean section, with the inevitable outcome being the death of the woman as she gives birth to her child.
Since learning the song, and finding it unutterably sad, I’ve been wanting to know the history of the ballad’s transmission (somewhat complicated), if it is actually about Jane Seymour, the third wife of Henry VIII (it is), and whether or not Seymour did in fact have a caesarean section (maybe, maybe not).
The words from the film version (Sproule’s 1970s version) are very close to those recorded in The Penguin Book of English Folk Songs, selected from the Journal of the Folk Song Society and edited by R. Vaughan Williams and A.L.Lloyd (1959). This particular version was sung by a Mrs Russell of Upwey, Dorset, and transcribed in 1907. I tracked it down in the I.K. Barber stacks at UBC. Here’s how it appears on the page, with the tune she sang it to:
Their note to this ballad goes: “The story is a legendary re-working of historical fact. Jane Seymour, wife of Henry VIII, died on 24 October 1537, twelve days after the natural birth of her son, who later became Edward VI. Some said her death was due to clumsy surgery. We do not know how old this ballad is, nor if it derives from a piece called The Lamentation of Queen Jane, licensed for publication in 1560. The ballad has been collected in Devon (FSJ II 222) and Somerset (FSJ V 257), and a second Dorset version is given in FSJ III p.67. The Death of Queen Jane is No. 170 in Child’s collection.” p.113.
But there’s a bit more to it than this. The information I draw on here comes from an article by Alastair Vannan called “The Death of Queen Jane: Ballad, History, and Propaganda” which appeared in the Folk Music Journal in 2013 [1]. Vannan describes two main traditions from which this ballad can be traced: there is a literary, more formal print-based ballad first published in 1612 in A Crown-Garland of Golden Roses as “The Wofull Death of Queen Jane, wife to King Henry the Eight: and how King Edward was cut out of his mother’s belly”; and then there is the vernacular ballad tradition. Although presumably long in oral circulation, the first known recording of this was in 1776, “sent to Thomas Percy by Thomas Barnard, Dean of Derry, transcribed from the memory of his mother” (Vannan p.349). The vernacular tradition has existed through time in many variations, from the sixteenth century through Inside Llewyn Davis (and now onwards to YouTube, where people who have seen the film are now recording and posting their own covers).
First, the print-based ballad, which appeared in 1612: “The Wofull Death of Queen Jane….” This is a ballad of nine 8-line stanzas, to be sung to the tune of “The Lamentation for the Lord of Essex.” The ballad describes how Jane was “in travell, pained sore/Full thirty woeful daies and more,/And no way could delivered be.” Here are the two crucial stanzas:
Being thus perplext with greif and care,
A lady to him did repaire,
And said, ‘O King! show us thy will,
The queene’s sweet life to save or spill.
If she cannot delivered be.
Yet save the flower, if not the tree!’
Oh! mourne, mourne, mourne, faire ladies,
Jane, your queen, the flower of England dies.
Then down uppon his tender knee
For help from heaven prayed he:
Meane while into a sleepe they cast
His queene, which ever more did last;
And opening then her tender womb.
Alive they tooke this budding bloome.
Oh! mourne, mourne, mourne, faire ladies,
Jane, your queen, the flower of England dies.
It’s fussier than the vernacular version sung by Mrs Russell of Upwey, Dorset (and now Oscar Isaac) which I’ve quoted in full above. By contrast, the vernacular is spare, and powerful in its stark portrayal of loss. And as with all vernacular ballads, it has greater dramatic presentation of the story. The print ballad is told from a distanced perspective; the queen doesn’t speak; the King’s knee is tender, as is the Queen’s womb. There are too many words.
Here’s a stanza from the vernacular version recorded by Child (Ballad 170): “The Death of Queen Jane”:
‘O royal King Henry, do one thing for me:
Rip open my two sides, and save my baby!’
‘O royal Queen Jane, that thing will not do;
If I lose your fair body, I’ll lose your baby too.’
Now Jane and Henry are both given words to speak; these carry some of the dramatic action. Vannan points out that the burden of responsibility for Jane’s death is now shifted to Jane, who asks for the surgery to be done, thus absolving Henry for taking such a decision (more on this shortly). As with the print-based ballad, Jane is still described as the flower of England. It ends with her death:
The baby was christened with joy and much mirth,
whilst poor Queen Jane’s body lay cold under earth:
There was ringing and singing and mourning all day,
The princess Elizabeth went weeping away.
In the film version of the ballad I puzzled a little over the line “If I lose the flower of England, I shall lose the branch too.” Jane is the flower of England, so the branch is the baby? But it would make more sense to think of Jane as the branch, and the baby as the flower. Vannan notes that the print-based ballad confuses the two: Jane is described as the flower of England, but the ballad also “somewhat confusingly refers to Jane as the tree that bore the flower that was Edward. In contrast, the vernacular ballads employ a similar vegetal metaphor for the lineage but avoid reattributing the flower symbol by referring to Edward as the branch.” So Mrs Russell’s version goes: “‘oh no,’ says King Henry, ‘that’s a thing I’ll never do,/If I lose the flower of England, I shall lose the branch too.'” The vernacular wanted to think of Jane as the flower, so Edward became the branch.
But of course, what makes this such a powerful song is the terrible request made by Jane, first to her ‘good women’ as she lies in labour, and then to King Henry himself. Terrible because stated in such plain language: “Will you do one thing for me/Will you open my right side, and find my baby.” Vannan records what is known about Jane Seymour’s labour: she went into labour on 9 October 1537; by 11 October the baby had still not been delivered (at this point rumours of a caesarean delivery were circulating); after two days and three nights of labour she gave birth to Edward. The christening was on the 15th. The “churching” ceremony took place on the 16th (“the blessing customarily given to mothers who have recovered after childbirth, suggesting that she was expected to make a full recovery”). On the 17th of October she began to experience fever and delusions. She was given last rites. On the 24th of October she died.
Almost immediately there were rumours of a caesarean section resulting in her death, but also rumours of puerperal fever (“childbed fever”), which was the most common form of death for women in childbirth, of pneumonia causing death, of exhaustion causing death, even of death due to “aggressive stretching of her limbs in order to aid the birth.” She would have been in confinement long before she went into labour; her absence from public view for well over a month, followed by her death, as Vannan points out, would have lent itself to the circulation of rumours. He also notes that many historians have attributed the rumours of Henry choosing the caesarean, that is, choosing the child over the mother’s life, to Catholic propaganda. Yet the earliest account of a caesarean, he says, comes from the archives of the Rolls Chapel (a “repository for documents produced by the medieval high court of Chancery, and also for documents from the royal household and other official papers.”) This was not a Catholic source, and an entry that likely came within a month of her death “states that Henry VIII was given the choice of whether preference should be given to the survival of the queen or of the child, and that he chose the child, after which surgery was performed.”
All versions of the ballad, says Vannan, whether the print-based “Wofull Death of Queen Jane” or the many vernacular versions, all emphasize a choice between saving the mother or the child, and of a caesarean being performed. He says that although there is no definitive evidence for or against a caesarean having been performed (and they were performed at this time, rarely successfully, usually on a woman who had already died) it is most likely “the belief that Jane Seymour died following a caesarean section was in wide and general circulation during the sixteenth and seventeenth centuries.” The vernacular ballads sympathize with Henry by shifting the responsibility for the decision to Jane. The gap of twelve days between the birth of Edward and Jane’s death could be attributed not only to puerperal fever, but also to the onset of septic peritonitis following the first changing of the surgical dressings if a caesarean had been carried out. But there’s no strong evidence either way. [2]
Whether or not Jane Seymour had a caesarean, we know that she died from giving birth. Labour reduces you to pure body. There is only the pain, and the desire for it to end, to no longer be in your body. The ballad rings true to me — a woman asking for the unendurable pain of her labour to end, for someone to end it for her.
Vannan also speaks to the truth of this ballad when he records this anecdote: “When Cecil Sharp was collecting songs in the Appalachians he took down ‘The Death of Queen Jane’ from Kate Thomas, of St. Helen’s, Lee County, Kentucky, and when she had finished singing he told her that the ballad was founded on historical fact, at which she exclaimed: ‘There now. I always said it must be true because it is so beautiful.'”
[1]Volume 10, Issue 3, pages 347 to 369.
[2] But see Richard L. DeMolen’s “The Birth of Edward VI and the Death of Queen Jane: The Arguments for and against Caesarean Section” in Renaissance Studies, Volume 4, Number 4 (1990). DeMolen offers an exhaustive review of the evidence (including the many variants of the ballad) and argues that a Caesarean was in fact performed on Jane while she was still living.
Thomas Wyatt’s heart
March 24, 2013 § Leave a comment
Alas, and is there no remedy
But have I thus lost it wilfully?
Iwis it was a thing all too dear
To be bestowed and wist not where:
It was mine heart! I pray you heartily
Help me to seek.
Just now I am reading Nicola Shulman’s Graven with Diamonds: The Many Lives of Thomas Wyatt: Courtier, Poet, Assassin, Spy. I was immediately drawn to Shulman’s insistence that in Wyatt’s time, poetry had uses — it could do things (Wyatt’s poetry a refutation, she argues, of Auden’s “Poetry makes nothing happen.”). There are two aspects of this claim that converge with my own preoccupations with the uses of poetry: first, the simple idea that a poem can have a particular effect in the world, and second, that the political context, the system, within which a poem is written, will imprint its language and determine its uses.
I want to return to this second point in a later post that considers the political system in relation to a poem’s production and its strategies of resistance to oppressive political structures; Clare Cavanagh’s important book, Lyric Poetry and Modern Politics: Russian, Poland, and the West, has much to say on this subject. Cavanagh points out that the very fact that poetry has no immediate material or economic use, and resists any attempts to control or organize it (as socialist realism tried to do), paradoxically increased its value in post-war Poland — the lyric poem came to represent a kind of elusive freedom, a private space which the state sought to annihilate. This makes me think also of John Donne’s insistence, over 300 years earlier, on the lovers’ room as a private space where the state must not intrude (“Busie old foole, unruly Sunne,/Why dost thou thus,/Through windowes, and through curtaines call on us?”) — although in Donne’s poetry this private space is often defined in opposition to, and appropriates the language of, the state.
The freedom of the lyric is linked to the metaphorical and polyvalent nature of language in this most compressed form; meaning is elusive; a line can be interpreted in multiple ways. Shulman explores Wyatt’s adept use of the poem as encrypted message. She points out that “Historicist critics…began to realise that Wyatt, like Mandelstam or Akhmatova, was a poet writing under tyranny, who might yield insights into life under the Tudor Stalin” (p.16). [1] Wyatt’s poems she suggests can be read as coded responses to the complex web of power at the court of Henry VIII; his ‘lute’ is symbol of the poet’s ability to speak freely: “My lute and strings may not deny/But as I strike they must obey….Blame not my lute”.
But it is her first point I am more interested in for now: that in Wyatt’s time, poetry had social currency; it could do things. Shulman demonstrates the function of a Wyatt poem within the game of courtly love as it was played in the court of Henry VIII, a game designed to channel the sexual frustrations of young men and women in confined quarters. The women needed to preserve their virginity in order to enter into the lists of marriage, which consolidated economic and family ties. The men, as always, had less to lose. Both wanted sex, and couldn’t have it. Courtly love codified and sublimated these heterosexual desires in its games, its masques, its poems, its role-playing; young men could be lovers addressing their Lady; if they couldn’t have sex, they could all at least play the game. (And perhaps, Shulman notes, some played the game as cover for an actual affair, which must have heightened the excitement of the game, and the affair.) Here’s where Wyatt comes in — poems played a significant role in the game, and Wyatt could write a good poem.
Shulman observes that “an early 16th-century lyric was more than the words that were written in it. It had a life as a material object as well. To us now, a poem means the same whether we read it on a computer screen or in a newspaper or a book of poetry; but to the ladies and gentlemen of the early Tudor court, a poem on a piece of paper was also a material thing, like a flower or a handkerchief, or a jewel” (p.72). This was true also in the imperial court of Heian Japan where poetry served various social functions, including its use by officials as a form of inter-governmental memo [2]; similarly, a poem’s physical appearance and presentation — kind and colour of paper, folded in a particular way, delivered at a particular time, attached to an iris root or sprig of cherry blossom — played as meaningful a role as the words themselves.
But I have promised Thomas Wyatt’s heart:
Help me to seek for I lost it there;
And if that ye have found it, yet that be here,
And seek to convey it secretly
Or else it will plain and then appair.
But rather restore it mannerly
Since that I do ask it thus honestly,
For to lose it it sitteth me too near.
Help me to seek.
Alas, and is there no remedy
But have I thus lost it wilfully?
Iwis it was a thing all too dear
To be bestowed and wist not where:
It was mine heart! I pray you heartily
Help me to seek.
The riddle lies, Shulman tells us, in the knowledge that the heart he seeks was a heart-shaped cloth-covered balloon that would “plain and then appair” — complain and then be damaged — with rough handling; it would have been used in some undocumented game of hide and seek played by the courtly lovers. The poem might have been a clue, instructions on how to play the game. Within that particular social context, the poem comes to life. I like this observation Shulman then makes about the poem as a light bulb of sorts: “When we think of a courtly lyric we must imagine it as a thing with latent energy, that lit up when the right social circuitry was connected” (p.85) — poetry as currency.
[1] I’ve seen estimates for the number of victims under Stalin’s reign range between 20 000 000 and 60 000 000; estimates for the number of victims under Henry VIII, between 54 000 and 72 000. I don’t know what this represents proportionally of the citizens under their control.
[2] In The World of the Shining Prince: Court Life in Ancient Japan, Ivan Morris observes of a new government appointment in the year 962: “…when a certain Imperial Prince who is serving as Minister of Military Affairs wishes to ask the newly appointed Assistant Minister why he is so lax in reporting for duty, he does not dream of sending the curt memorandum that would be normal in a more businesslike form of bureaucracy; instead he indites an elegant poem, replete with word-plays, in which he compares the Assistant Minister and himself to two strands that have been coiled together in a single thread and asks his subordinate why he has stopped ‘reeling the silk.’ There follows a long exchange of increasingly obscure poems, all ringing the changes on the silk-reeling image, in the course of which the two gentlemen appear to have forgotten entirely about the original, rather prosaic, purpose of their correspondence” (p.192).
the DNA of Shakespeare’s Sonnets
January 25, 2013 § Leave a comment
“TAGATGTGTACAGACTACGC…..” (Thou art more lovely and more temperate...)
An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.
I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.” Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.
So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.
This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).
Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.
Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.
The earliest forms of poetry also carried practical information—poems do things: Hesiod’s Works and Days; perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.
And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.
The Guardian article explains how the encoding takes place:
“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.
To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”
This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.
Then the DNA is stored in a dry, cool, dark place.
A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.
But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate. Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…” Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.
In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.
kim trainor 