the poem as participating in the ongoing human project of making the world

February 2, 2013 § Leave a comment

How is a poem like a coat? In The Body in Pain: The Making and Unmaking of the World, Elaine Scarry develops Marx’s insight that the human body is an artefact that is constantly being remade by means of the artefacts which we produce, and by so doing we participate in the ongoing human project of making the world. Material objects hold and extend our sentience. She notes Marx’s description of cloth, for example, as memorialization of the body: “the woven cloth is a material memorialization of the embodied work of spinning, for it endures long after the physical activity has itself ceased” (p.247); the raw material is “soaked in labour” (p.247).

How do these material objects extend our sentience and rework it?  The telephone extends hearing, the telescope or microscope, sight; and so on; sentience is now “objectified in language and material objects and is thus fundamentally transformed to be communicable and endlessly sharable” (p.255):

“…human beings project their bodily powers and frailties into external objects such as telephones, chairs, gods, poems, medicine, institutions, and political forms, and then those objects in turn become the object of perceptions that are taken back into the interior of human consciousness where they now reside as part of the mind or soul, and this revised conception of oneself—as a creature relatively untroubled by the problem of weight (chair), as one able to hear voices coming from the other side of a continent (telephone)….is now actually ‘felt’ to be located inside the boundaries of one’s own skin where one is in immediate contact with an elaborate constellation of interior cultural fragments that seem to have displaced the dense molecules of physical matter” (p.256).

The object returns to us; sentience itself is reworked. Words also become external objects in which we invest our sentience: the words we speak and write are grounded in our bodies, and assume a physical form, whether through the voice which speaks words or the movements of our hands and fingers to produce writing. Words spoken involve breath and vibration. The writer holds the pen in her hand or types at the computer; fingers, tendons, muscles, wrapped around bone, enclosed in skin, produce letters, whether in digital form or as traces of ink. In this way a song or a poem, a stitched fabric of words, is also a material artefact which goes out into the world, and then returns.

Scarry’s discussion of the artefact as lever is carried out within her larger consideration of the ways in which torture and war “unmake” the world, attempt to destroy and take apart objects, institutions, language itself. The artefact plays an important role in the aftermath, in the making or remaking of this damaged world. In particular, she emphasizes the artefact as “lever,” with powers of projection and reciprocation.

Projecting human sentience into objects, an awareness, a knowledge of human needs, is only one part of the equation. Second, comes reciprocation: we can then think of the artefact as a lever or fulcrum, that moves this force of creation back again from itself, from the external or natural world, to human beings, recreating, remaking, extending our powers. This holds for a single poem, or an entire library; Scarry is wide-ranging in her embrace of all kinds of human artefacts, from common domestic objects such as the clothespin, the chair, the cloth, to the polis or nation-state and even the Judeo-Christian God (an act of collective human imagining). She observes that this reciprocation is almost always magnified. 

This is where the coat and its relation to the poem, comes into her argument.

She asks us to consider a coat made by a woman called Mildred Keats: she spends 2 weeks making the coat, but wears it for 20 years (here is the magnification effect of the artefact as lever). The 2 weeks of physical discomfort while she sews the coat are repaid many times by the warmth and mobility it provides her, thus freeing up her awareness of her body and its needs so that she can work on other aspects of world-making.

Similarly, John Keats writes a poem. He projects his own private thoughts and emotions into the poem (if inevitably imprinted by the discursive context in which he writes); it is printed, circulated, and now exists in the world of material objects for us to read. Perhaps it takes him 3 hours to write “Ode to a Nightingale.” It is still with us almost 200 years later. Each time it is read, “its power now moves back from the object realm to the human realm where sentience itself is remade” (p.307). We breath into his words, give them life; and they work on us too, reworking our consciousness.

This is a modest claim, then, for poems as artefact-levers, like coats, which are projected out into the world, and then return, magnified, modifying consciousness through time.

the DNA of Shakespeare’s Sonnets

January 25, 2013 § Leave a comment

“TAGATGTGTACAGACTACGC…..”   (Thou art more lovely and more temperate...)

An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.

I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.”  Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.

So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.

This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).

Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.

Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.

The earliest forms of poetry also carried practical information—poems do things:  Hesiod’s Works and Days;  perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.

And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.

The Guardian article explains how the encoding takes place:

“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”

This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.

Then the DNA is stored in a dry, cool, dark place.

A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.

But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate.  Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…”  Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved  in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.

In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.

Where Am I?

You are currently browsing the the use of poetry category at kim trainor.