poems and other domestic objects

April 6, 2013 § Leave a comment

“It is worth one’s while, at certain hours of the day or night, to scrutinize useful objects in repose: wheels that have rolled across long dusty distances with their enormous loads of crops or ore, charcoal sacks, barrels, baskets, the hafts and handles of carpenter’s tools. The contact these objects have had with man and earth may serve as a valuable lesson to a tortured lyric poet. Worn surfaces, the wear inflicted by human hands, the sometimes tragic, always pathetic, emanations from these objects give reality a magnetism that should not be scorned.

Man’s nebulous impurity can be perceived in them: the affinity for groups, the use and obsolescence of materials, the mark of a hand or a foot, the constancy of the human presence that permeates every surface.”

–from “Some Thoughts on Impure Poetry,” quoted in the Introduction to Residence on Earth xii-xiii

Neruda, who wrote odes on socks, a table, a chair, here describes the marks of labour carried by objects. In an earlier post (“the poem as artefact that carries traces of its own making”) I’ve considered, with reference to Elaine Scarry’s extension of Marx in The Body in Pain, the traces of making that objects carry — the cloth which is “soaked” in labour, which carries traces of sweat, blood, the pin pricks and marks, the very weave of the cloth — and the subsequent alienation of the maker from such labour.

The objects Neruda describes here seem to come largely from the stereotypically masculine realm of labour: carpenter’s tools, wheels that bear heavy crops, charcoal sacks. Does he romanticize these common objects, and is there an attempt also to valorize poetry — I mean, to give more every day value to it — by placing it on the same footing as a sack that carries charcoal, or a wheel that bears a heavy load?

Heaney’s poetry also values such tools and the labour of the farm, in his case, the result of his having been raised on a small farm-holding in Northern Ireland. From his earliest collection, with the pen as substitute for the spade (and gun), he invokes the earth. Later collections return often to the trope of the plough and the ploughshare (again, with reference to the boustrophedon and versus, to the modern line’s turn at the end of each verse, and to the lovely image of the poem which turns back time):

My father’s ploughing one, two, three, four sides
Of the lea ground where I sit all-seeing
At centre field, my back to the thorn tree
They never cut. The horses are all hoof
And burnished flank, I am all foreknowledge.
Of the poem as a ploughshare that turns time
Up and over…

–‘Poet’s Chair,’ in The Spirit Level

The many domestic objects which work their way into his poetry are not limited to the masculine realm. There’s the turnip-snedder in District and Circle: in an age of “bare hands/and cast iron,//the clamp-on meat-mincer,/the double flywheeled water-pump,//it dug its heels in among wooden tubs/and troughs of slops…” There’s also the beautiful dedicatory poems to North, in particular “Sunlight,” dedicated to his aunt Mary:

There was a sunlit absence.
The helmeted pump in the yard
heated its iron,
water honeyed

in the slung bucket
and the sun stood
like a griddle cooling
against the wall…

He goes on to describe her floured hands and apron as she makes scones, the “plaque of heat” given off by the stove, dusting the board with a goose’s wing. Then comes the quiet moment as she has time to rest between work:

here is a space
again, the scone rising
to the tick of two clocks.

And here is love
like a tinsmith’s scoop
sunk past its gleam
in the meal-bin.

Time is love and food, and the preparing of it, and plenitude — love as a scoop that is “sunk past its gleam.” North quickly descends into the darkness of myth, but still finds its ground in the archaeological objects of a distant Viking and Iron Age past. In this description of baking in the dedicatory poem, there is still the fairly strict demarcation of male and female roles, as there also tends to be when Heaney lays out his various schemata of English/Irish roots in his theoretical explorations of his own poetry: masculine, consonantal, air, clarity and light, the long line of iambic pentameter, all contrasted with feminine, vowelled, earth, darkness, the short, cutting line of North.

I turn often to Eavan Boland to read poetry with domestic objects and experiences from a woman’s perspective: fabric, cloth, the kitchen, children, illness, the confined spaces of small rooms in the suburbs. Boland is particularly fine in her poems that incorporate cloth. For example, in The Journey when she describes her search for a language like lace, or in “The Unlived Life,” her description of quilting in the new world:

to formalize the terrors of routine
in the algebras of a marriage quilt
on alternate mornings when you knew
that all you owned was what you shared.

Cloth in its long history is the history of women.  Elizabeth Wayland Barber traces this labour in Women’s Work: The First 20,000 Years: Women, Cloth, and Society in Early Times, and in The Mummies of Ürümchi, where she describes the woven textiles of the Beauty of Loulan and other mummies found on the edge of the Taklamakan desert, along the old Silk Road. Cloth, like DNA, carries signatures, traces of its history, of how and when it was made, of where it comes from. Cloth is analogue for language and for skin, which comes into close contact with another.

In The Material of Poetry, Gerald Bruns, citing Levinas, describes poetry as object, as ethical contact with the world, language as skin. The aural qualities of a poem operate on a different level from the visual which emphasizes objectification, sudden complete comprehension, totality, versus the unfolding of sound over time, which is partial, incremental, and intimate as touch (as radio is more intimate than television). Poetry requires listening, which

“involves a form of subjectivity — indeed a kind of experience — different from seeing; it implies or entails a porous, as against a self-contained, mode of being, and it also implies a different world from the one that seeing, perception, observation or conceptualization constructs or projects onto the screen of consciousness. In an essay on ‘The Transcendence of Words,’ Levinas says, ‘To see is to be in a world that is entirely here and self-sufficient.’ Sound, however, undoes this state of self-sufficiency and contentment — and it is important to know that Levinas is thinking of the sounds of words rather than, say musicalized or harmonized sounds. Specifically, he is thinking of voiced sounds in which sound is no longer a semantic medium or the embodiment of aesthetic form but rather a mode of sensibility irreducible to vision, comprehension, or containment within categories.” p.44

Bruns is referring here to the role of sound in poetry over and above its semantic content; we’re within earshot perhaps of Kristeva’s distinction between genotext and phenotext. He notes also how sound overwhelms the firm borders of the self; “sound bleeds the self.” p.45. Listening to a poem is to exist in the “mode of being touched.” p.43 The poet’s relationship to language is one of listening. [1]

Similarly, Robert Pinsky, in Democracy, Culture, and the Voice of Poetry, speaking of the Favourite Poem Project, describes the reading of a poem as being inhabited by it, of giving oneself up to this mode of being touched. In fact, the reader becomes “an actual, living medium for the poem.” p.61 This is Jane Hirshfield again, on taking the poet’s breath into your body, to give life to his or her words once more. There is a cohabitation in this, a living with another for the time it takes to speak the poem, a willingness to become the medium for that person’s voice.

But I have gone somewhat astray — or perhaps not. The experience of a poem, as in the wearing of cloth, or in the pleasure of touch, is one of proximity. I was describing cloth as analogue of poem and skin. In Boland’s poetry cloth is intimate with the human body, linked to both labour and desire, and its accompanying dangers:

Tonight in rooms where skirts appear steeped in tea
when they are only deep in shadow and where heat
collects at the waist, the wrist, is wet at the base of the neck,
the secrets of the dark will be the truths of the body
a young girl feels and hides even from herself….

(2. How the Dance Came to the City in Domestic Violence)

Boland describes many other kinds of domestic objects in her poetry. Here she is writing about antibiotics, from the title poem of The Journey:

And then the dark fell and ‘there has never’
I said ‘been a poem to an antibiotic:
never a word to compare with the odes on
the flower of the raw sloe for fever

Depend on it, somewhere a poet is wasting
his sweet uncluttered metres on the obvious

emblem instead of the real thing.

Perhaps I am stretching things by thinking of an antibiotic as artefact or domestic object, but I take my lead from Scarry and her wide-ranging account of the role of human artefacts, including language, in making the world. This brings me back to Neruda again, and his insistence on an impure poetry, an insistence on poem as labouring object, and Scarry’s description of a poem as being able to work on the world in a positive sense, to rework it, and change ourselves as a result.  I’m thinking of the use of a poem in a very diffuse way as this ability to work upon the world by working upon — by touching — another’s consciousness, and transforming it.

[1] I’m less convinced by Bruns’ defence of sound poetry as joyous vociferation; what he describes as an opening of the self to sound (and he describes exclusively male projects and projections here) feels more like unwelcome, one-way invasion, of being forced open.

Thomas Wyatt’s heart

March 24, 2013 § Leave a comment

Alas, and is there no remedy
But have I thus lost it wilfully?
Iwis it was a thing all too dear
To be bestowed and wist not where:
It was mine heart! I pray you heartily
Help me to seek.

Just now I am reading Nicola Shulman’s Graven with Diamonds: The Many Lives of Thomas Wyatt: Courtier, Poet, Assassin, Spy. I was immediately drawn to Shulman’s insistence that in Wyatt’s time, poetry had uses — it could do things (Wyatt’s poetry a refutation, she argues, of Auden’s “Poetry makes nothing happen.”).  There are two aspects of this claim that converge with my own preoccupations with the uses of poetry: first, the simple idea that a poem can have a particular effect in the world, and second, that the political context, the system, within which a poem is written, will imprint its language and determine its uses.

I want to return to this second point in a later post that considers the political system in relation to a poem’s production and its strategies of resistance to oppressive political structures; Clare Cavanagh’s important book, Lyric Poetry and Modern Politics: Russian, Poland, and the West, has much to say on this subject. Cavanagh points out that the very fact that poetry has no immediate material or economic use, and resists any attempts to control or organize it (as socialist realism tried to do), paradoxically increased its value in post-war Poland — the lyric poem came to represent a kind of elusive freedom, a private space which the state sought to annihilate. This makes me think also of John Donne’s insistence, over 300 years earlier, on the lovers’ room as a private space where the state must not intrude (“Busie old foole, unruly Sunne,/Why dost thou thus,/Through windowes, and through curtaines call on us?”) — although in Donne’s poetry this private space is often defined in opposition to, and appropriates the language of, the state.

The freedom of the lyric is linked to the metaphorical and polyvalent nature of language in this most compressed form; meaning is elusive; a line can be interpreted in multiple ways. Shulman explores Wyatt’s adept use of the poem as encrypted message. She points out that “Historicist critics…began to realise that Wyatt, like Mandelstam or Akhmatova, was a poet writing under tyranny, who might yield insights into life under the Tudor Stalin” (p.16).  [1]  Wyatt’s poems she suggests can be read as coded responses to the complex web of power at the court of Henry VIII; his ‘lute’ is symbol of the poet’s ability to speak freely: “My lute and strings may not deny/But as I strike they must obey….Blame not my lute”.

But it is her first point I am more interested in for now: that in Wyatt’s time, poetry had social currency; it could do things. Shulman demonstrates the function of a Wyatt poem within the game of courtly love as it was played in the court of Henry VIII, a game designed to channel the sexual frustrations of young men and women in confined quarters. The women needed to preserve their virginity in order to enter into the lists of marriage, which consolidated economic and family ties. The men, as always, had less to lose. Both wanted sex, and couldn’t have it. Courtly love codified and sublimated these heterosexual desires in its games, its masques, its poems, its role-playing; young men could be lovers addressing their Lady; if they couldn’t have sex, they could all at least play the game. (And perhaps, Shulman notes, some played the game as cover for an actual affair, which must have heightened the excitement of the game, and the affair.) Here’s where Wyatt comes in  — poems played a significant role in the game, and Wyatt could write a good poem.

Shulman observes that “an early 16th-century lyric was more than the words that were written in it. It had a life as a material object as well. To us now, a poem means the same whether we read it on a computer screen or in a newspaper or a book of poetry; but to the ladies and gentlemen of the early Tudor court, a poem on a piece of paper was also a material thing, like a flower or a handkerchief, or a jewel” (p.72). This was true also in the imperial court of Heian Japan where poetry served various social functions, including its use by officials as a form of inter-governmental memo [2]; similarly, a poem’s physical appearance and presentation — kind and colour of paper, folded in a particular way, delivered at a particular time, attached to an iris root or sprig of cherry blossom — played as meaningful a role as the words themselves.

But I have promised Thomas Wyatt’s heart:

Help me to seek for I lost it there;
And if that ye have found it, yet that be here,
And seek to convey it secretly
Or else it will plain and then appair.
But rather restore it mannerly
Since that I do ask it thus honestly,
For to lose it it sitteth me too near.
Help me to seek.

Alas, and is there no remedy
But have I thus lost it wilfully?
Iwis it was a thing all too dear
To be bestowed and wist not where:
It was mine heart! I pray you heartily
Help me to seek.

The riddle lies, Shulman tells us, in the knowledge that the heart he seeks was a heart-shaped cloth-covered balloon that would “plain and then appair” — complain and then be damaged — with rough handling; it would have been used in some undocumented game of hide and seek played by the courtly lovers. The poem might have been a clue, instructions on how to play the game. Within that particular social context, the poem comes to life. I like this observation Shulman then makes about the poem as a light bulb of sorts: “When we think of a courtly lyric we must imagine it as a thing with latent energy, that lit up when the right social circuitry was connected” (p.85) — poetry as currency.

[1] I’ve seen estimates for the number of victims under Stalin’s reign range between 20 000 000 and 60 000 000; estimates for the number of victims under Henry VIII, between 54 000 and 72 000. I don’t know what this represents proportionally of the citizens under their control.

[2] In The World of the Shining Prince: Court Life in Ancient Japan, Ivan Morris observes of a new government appointment in the year 962: “…when a certain Imperial Prince who is serving as Minister of Military Affairs wishes to ask the newly appointed Assistant Minister why he is so lax in reporting for duty, he does not dream of sending the curt memorandum that would be normal in a more businesslike form of bureaucracy; instead he indites an elegant poem, replete with word-plays, in which he compares the Assistant Minister and himself to two strands that have been coiled together in a single thread and asks his subordinate why he has stopped ‘reeling the silk.’ There follows a long exchange of increasingly obscure poems, all ringing the changes on the silk-reeling image, in the course of which the two gentlemen appear to have forgotten entirely about the original, rather prosaic, purpose of their correspondence” (p.192).

the poem as trace of an event 2

February 28, 2013 § 2 Comments

Five miles away the hayricks and houses
are going up in fire;
beside the fields, peasants smoke their pipes
in silence and in fear.
Here, the lake still ripples at the little
shepherdess’s stride;
on the water a ruffled flock of sheep
stoops to drink a cloud.

Cservenka, 6th Oct. 1944

— “Razglednica (2)”  (Postcard 2), Miklós Radnóti, transl. Francis R. Jones

Beyond local, small-scale ecological witnessing, such as that of Borodale, Oswald, Longley, (discussed in “the poem as trace of an event 1“) some poets become directly caught up in larger historical events, these bloody trajectories of the 20th and 21st centuries, events which are then registered in their poetry in various ways — or sometimes deliberately resisted: Czesław Miłosz, on refusing permission to reprint some of his poems on the Warsaw Uprising: “I do not want to be known as a professional mourner.” (See his interview in The Paris Review.)

What kind of knowledge might a poem carry of an event such as that of the Hungarian poet Miklós Radnóti’s forced march of early November 1944, a march which ended in his execution in a mass grave?

Even during this march Radnóti managed to continue to write small poems in a soft-covered notebook, now known as the “Bor Notebook,” or sometimes “Camp Notebook.” (An online facsimile of it can be found here, from a 2009 exhibit of his work.) This was a small, square-ruled notebook which was later found on his body when the grave where he had been buried was exhumed after the war. [1]

Perhaps the very question is wrong, suggesting a desire for some utility for poetry, a desire that we can trace back in the English tradition at least to Sir Philip Sidney’s Defence of Poesy (published 1595), who argued that poetry should both teach and delight, and which finds expression today in the “ethical turn” in literary studies. David-Antoine Williams offers an informative overview of this ethical turn in chapter 1, “Ethics, Literature, and the Place of Poetry,” of his Defending Poetry: Art and Ethics in Joseph Brodsky, Seamus Heaney, and Geoffrey Hill (2010). Tellingly, he notes that the focus of this ethical turn has been on narrative. Williams observes,

“Many writers on the ethics of literature simply ignore poetry and the poetic altogether: if the neo-Aristotelian didactic and the responsibility-oriented deconstructive streams of ethical criticism share anything, it is that both rely on broad theories of narration, which is to say they regard real or imagined human actions, consequences, and fates (usually) within social situations. It is the narrative components of novels, stories, dramas, etc. that are discussed and debated over, not, usually, their formal effects […] it is unclear where narrative-dependent ethical criticism leaves poetry, especially lyric poetry. Attempts to account for an ethics of poems are often perforce drawn back to narration: Susan Gubar, in discussing recent Holocaust poetry, ultimately locates its ethics in its ability ‘to counter the numbing amnesia inflicted on its casualties by traumatic injury and on their descendants by our collective overexposure to widely circulated narratives of attrocity.’ In other words, poetry’s ethicity depends on the extent to which its narratives can replace or refresh old, worn ones. Unsurprisingly, Gubar’s analysis never lingers on anything non-narrative, formal, or even ‘poetic’ in the poetry she treats.” (p.18)

So when I ask what knowledge a poem such as Radnóti’s “Razglednica (2)”, which I quoted above, might carry, I am thinking of knowledge and an ethical force beyond that which narrative holds. In any lyric poem we find both narrative and lyric elements, where the lyric often bears a heightened focus on language’s own procedures, by means of its formal elements. Williams is pointing here towards these procedures and formal qualities, and how they might be associated with a poem’s “ethicity”.[2]

An initial difficulty in concentrating upon “Razglednica (2)” as a lyric poem is its contextual history. Note that the poem is always published with the place and date of its writing — Cservenka, 6th Oct. 1944; Radnóti was on the forced march by this time. The original notebook includes these details of place and date following each poem, as if a “signature;” all versions of the poems in translation I have read follow him in this. And this signature invites us to always read the ‘postcard’ — ‘razglednica’ is the Serbian word for ‘postcard’ — within the context of his lived history and witnessing, as if each postcard-poem describes an image or snapshot from the march, the ghostly “reverse” of the poem; the notebook itself is often described as a witness from beyond the grave. But does this then relegate his razglednici to mere documentary snapshots of his own slow torture and death? They are often read as transcription or witness of these events, analogous to a newspaper report, as in the final razglednica, where he describes the killing of an acquaintance, which could also be a postcard documenting his own execution several weeks later. Yet what remains then of its status as lyric poem?

“Razglednica (2)” is the second of four such postcard-poems he wrote in the last months of his life. In them Radnóti invokes the pastoral tradition. He was a trained classicist, and some of his work consisted of making translations of Virgil, among others; Radnóti’s finest poems I think are his own “Eclogues,” which incorporate this Virgilian mode of social critique and lament with elements drawn directly from his experiences during the war — for example, in the Second Eclogue, instead of staging a dialogue with a peasant, he speaks with a military pilot who conducts bombing raids by night: “Pilot: Went far out into the night; I laughed, I was so mad./Like swarms of bees the fighter planes buzzed overhead…” (Transl. Emory George, p.230).

Similarly in “Razglednica (2),” the war is invoked; the image of a flock of sheep which stoops to sip from a cloud-reflecting lake is framed by the five-mile-distant carnage of a village in flames. There is no significant narrative here; merely ironic juxtaposition of two images. I take pleasure in his description of the lake as if the sheep stoop to sip from a cloud, in his having taken note of this trompe l’oeil effect, presenting a verbal equivalent by means of metaphor. The invocation of the pastoral also invites us to consider the function of this lyric mode, and its very capacity to document or engage with the events of war, which it seems here to do most forcefully.

But I am still avoiding the issue of the formal qualities of the poem, as much as I can engage with them in a translation, not being able to read the original Hungarian. Radnóti often used classical and closed forms; the razglednici are written in quatrains, and employ cross rhyme; some of his translators attempt to offer similar formal patterns, while the Polgar, Berg, and Marks translation employs free verse. The decision to replicate the formal patterns is important, however, for his poems use these formal elements of poetry to stand against the chaos and unmaking of war. During the years of the war he made the deliberate choice of turning to classical structures, even though his earlier collections of poetry experimented with free verse; he seemed to have found strength in this formal patterning, so much so that he did not stop writing these poems, even under duress, as if the closed structures helped to order and contain the violence he witnessed.

Emery George’s 1980 translations of the entire corpus of Radnóti’s poetry attempt to preserve many of the formal qualities of Radnóti’s verse, as do the more recent translations by Zsuzsanna Ozsváth and Frederick Turner in their 1992 Foamy Sky: The Major Poems of Miklos Radnóti, and Francis R. Jones in Camp Notebook (2000). George notes he tries to follow Radnóti’s own translation principles:

“It would not do […] to render a hexameter work in ‘open’ form, any more than it would do to try to render it in Alexandrines or in blank verse. Every syllable contributes its share of the weight to careful work in meter or in the shaped line and stanza. Indeed fidelity requires that, wherever similarities in syntax permit it, even the relative positions of words be observed; that where lexicon and semantics favor it we show sensitivity to the possibility of sound repetition somewhere near the passage that exhibits it in the original […] In short, the translator of poetry had better have a good ear.” p.42]

He introduces all kinds of questions here regarding translation, but I want simply to note his insistence on the importance of form to Radnóti himself as translator and poet.

Here is George’s own translation of “Razglednica (2)”:

Nine kilometers from here the haystacks and
houses are burning;
sitting on the field’s edges, some scared and speechless
poor folk are smoking.
Here a little shepherdess, stepping onto the lake,
ruffles the water;
the ruffled sheep flock at the water drinks from
clouds, bending over.

The rhyme scheme, which both Jones and George preserve by means of slant rhyme is xaxa xbxb. Jones rhymes fire and fear, stride and cloud, while George strains towards burning/smoking, and water/over. Rhyme often reinforces semantic or emotional connections between words. In this, I find Jones’ translation more successful in the linking of fire to fear; the ambiguity of George’s poor folk ‘smoking,’ as if smouldering and not smoking a pipe, is unfortunate.

The two quatrains are used by Radnóti to set up two distinct images which contrast sharply and ironically with one another. In the first quatrain we see the distant, burning village and the peasant observers — and are perhaps reminded that we also watch, as from a great distance, this scene from almost seventy years ago. In the second quatrain a more typical pastoral image is presented of a shepherdess with her flock of sheep, which sip from the sky-reflecting lake. The ironic juxtaposition of the two images is strengthened by the formal elements of the first quatrain (alternating rhyme, line length) which are then mirrored in the second, as cloud is mirrored in lake, as the first image begins to obscure or cloud over the second as the war progresses.

George more successfully captures the rhythm of the original line, I suspect, with his use of a triple foot and falling rhythm. But I like the way in which Jones manages by means of enjambment to emphasize fire, silence, and fear in lines 2 and 4 of the first quatrain:

Five miles away the hayricks and houses
are going up in fire;
beside the fields, peasants smoke their pipes
in silence and in fear.

The first line with its reference to hayricks might be the opening of a simple pastoral quatrain, until the second line undercuts this with the words “are going up in fire.” Similarly, peasants smoking their pipes, another idyllic image, is quickly undercut by “in silence and in fear.” I don’t know if this effect is present in the original, but it is effective.

The very fact that Radnóti writes this poem while on a forced march, using elements such as metre and rhyme, quatrain form, image, metaphor, and the resultant compression of language this entails, can also be read as significant: he makes pattern out of a chaos of sound, a poem out of the chaos of war which, as Scarry observes in The Body in Pain, unmakes language along with many other human institutions. This tiny poem functions as counterforce to such destruction.

Similarly, I equally value in Radnóti’s poems from his Bor Notebook  the gesture of the individual voice, the single, quiet voice that speaks in the silence, in the dark.  As readers, we are allowed access to the imprint of his single consciousness — again an imprint that is found in the very formal qualities of the poem itself, a transcription of what this man thought as he rested in barracks (I don’t mean here a spontaneous trace of his conscious thought, but inevitably a re-presentation of this thought through formal means; Grossman–“Poems are fictions of the privacy of other minds. Wherever the philosopher says per impossibile the poet shows the way” p.147 Summa Lyrica), as in the magnificent “Seventh Eclogue” in which he describes a dream-journey from the forced labour camp back to his home:

from “Seventh Eclogue”

Look how evening descends and around us the barbed-wire-hemmed, wild
oaken fence and the barracks are weightless, as evening absorbs them.
Slowly the glance loses hold on the frame of our captive condition,
only the mind, it alone is alive to the tautness of wire.
See, Love: phantasy here, it too can attain to its freedom
only through dream, that comely redeemer who frees our broken
bodies — it’s time, and the men in the prison camp leave for their homes now.

(translation by Emery George, in The Complete Poetry)

Radnóti is using here the classical dactylic hexameter line, one which we are much less used to hearing in English, and which George attempts to reproduce — he speaks of Radnóti’s hexameter lines as having “grace, speed, and power” (p.42).

While Virgil uses hexameter lines to write the Eclogues, and this may be Radnóti’s more immediate model, we might consider also the use of the hexameter line as formal vehicle in epic poetry, foremost of which is the Iliad. In Susan Stewart’s Poetry and the Fate of the Senses (2002) she makes the useful distinction between the epic mode, which carries official ideologies, the state’s version of war, and the lyric mode, which, she argues, offers the perspective of the individual caught up in war, and carries traces of an individual’s sense-perceptions and emotions (p.296). Radnóti in his use of the hexameter line to write many of his last poems we might read as an undermining of this vehicle of official ideology; he uses it to convey the individual’s first-person experience of sensation and emotion, a private dream life in the midst of war. Frederick Turner in his translator’s essay in Foamy Sky, also notes the importance of this hexameter line in Radnóti’s poetry: “..the epic/pastoral hexameters of the first and eighth eclogues are fundamental to their meanings, recalling the power of Homer, the moral complexity of Virgil, and that strange Hadean combination of the arcadian and the heroic that we associate with the descent to the land of the dead” (p.xlvii).

Formal qualities are integral to the effect Radnóti seeks to achieve in these last poems. George acknowledges the documentary or trace aspect of Radnóti’s Bor poetry, and yet insists on their self-conscious attention to making:

“If ever there was art that moves beyond the naturalistically faithful documentation of life that it appears to be providing, it is the poems of the Bor Notebook. To be sure we have no reason not to accept at face value some of the conditions the poems depict, or — nearly so — some of the statements they represent a man as making. That the poet misses [his wife] Fanni and that he hopes to make superhuman attempts to return to her (“Seventh Eclogue,” “Letter to My Wife,” “Forced March”), that in the solitude of his brutish exile he is consoled by his thoughts (“Letter to My Wife,” “Eighth Eclogue”), that in the midst of his own predicament he is thinking of the many who have already met their fates in one form or another (“A la recherche….”) […] What may still need our attention is secrets of the poems not revealed by the images alone” (p.39).

George then goes on to note the deliberate invocation and undercutting of the pastoral, and the formal skill of the Bor poems, bearing “a hardness and diamond-like perfection” (p.40) In this, he is directing our attention to the formal over the documentary “trace” of this poetry.

Yet he also points out that the “Razglednica” as imitation “postcard” is part of a longer experimental tradition by Radnóti to engage with “letters, diary entries, newspaper reportage, expansions of poetic expression that parallel concrete and three-dimensional poetic happenings in our time” (p.40). Here Radnóti would seem to self-consciously engage with poem as documentary trace of an event.

[1] The Bor notebook comprised the 7th and 8th Eclogues, “Root,” “Letter to my Wife,” ” À la recherche,” “Forced March,” as well as the four Razglednici or postcard poems.

[2] Williams’ comment on Gubar and the role of narrative in poetry is not entirely fair. Consider her discussion of “Why poetry matters”  in chapter 1 of Poetry After Auschwitz: “poetry serves an important function here, for it abrogates narrative coherence and thereby sparks discontinuity […] In an effort to signal the impossibility of a sensible story, the poet provides spurts of vision, moments of truth, baffling but nevertheless powerful pictures of scenes unassimilated into an explanatory plot and thus seizes the past ‘as an image which flashes up at the instant when it can be recognized and is never seen again.’ According to Benjamin, images (not stories, which tend to recount the past so as to account for it) put the ‘then’ of the past into a dialectical relationship with the ‘now’ of the present, constitute a critique of the myth of progress, and promote mindfulness about how the past continues to exist as an outrage in the present.” p.7 That being said, however, I agree with him that in her actual treatment of individual poems, she glosses over more formally interesting poems by Celan, Forche, and others, concentrating largely on narrative-driven poetry, which she then herself critically narrates.

the poem as participating in the ongoing human project of making the world

February 2, 2013 § Leave a comment

How is a poem like a coat? In The Body in Pain: The Making and Unmaking of the World, Elaine Scarry develops Marx’s insight that the human body is an artefact that is constantly being remade by means of the artefacts which we produce, and by so doing we participate in the ongoing human project of making the world. Material objects hold and extend our sentience. She notes Marx’s description of cloth, for example, as memorialization of the body: “the woven cloth is a material memorialization of the embodied work of spinning, for it endures long after the physical activity has itself ceased” (p.247); the raw material is “soaked in labour” (p.247).

How do these material objects extend our sentience and rework it?  The telephone extends hearing, the telescope or microscope, sight; and so on; sentience is now “objectified in language and material objects and is thus fundamentally transformed to be communicable and endlessly sharable” (p.255):

“…human beings project their bodily powers and frailties into external objects such as telephones, chairs, gods, poems, medicine, institutions, and political forms, and then those objects in turn become the object of perceptions that are taken back into the interior of human consciousness where they now reside as part of the mind or soul, and this revised conception of oneself—as a creature relatively untroubled by the problem of weight (chair), as one able to hear voices coming from the other side of a continent (telephone)….is now actually ‘felt’ to be located inside the boundaries of one’s own skin where one is in immediate contact with an elaborate constellation of interior cultural fragments that seem to have displaced the dense molecules of physical matter” (p.256).

The object returns to us; sentience itself is reworked. Words also become external objects in which we invest our sentience: the words we speak and write are grounded in our bodies, and assume a physical form, whether through the voice which speaks words or the movements of our hands and fingers to produce writing. Words spoken involve breath and vibration. The writer holds the pen in her hand or types at the computer; fingers, tendons, muscles, wrapped around bone, enclosed in skin, produce letters, whether in digital form or as traces of ink. In this way a song or a poem, a stitched fabric of words, is also a material artefact which goes out into the world, and then returns.

Scarry’s discussion of the artefact as lever is carried out within her larger consideration of the ways in which torture and war “unmake” the world, attempt to destroy and take apart objects, institutions, language itself. The artefact plays an important role in the aftermath, in the making or remaking of this damaged world. In particular, she emphasizes the artefact as “lever,” with powers of projection and reciprocation.

Projecting human sentience into objects, an awareness, a knowledge of human needs, is only one part of the equation. Second, comes reciprocation: we can then think of the artefact as a lever or fulcrum, that moves this force of creation back again from itself, from the external or natural world, to human beings, recreating, remaking, extending our powers. This holds for a single poem, or an entire library; Scarry is wide-ranging in her embrace of all kinds of human artefacts, from common domestic objects such as the clothespin, the chair, the cloth, to the polis or nation-state and even the Judeo-Christian God (an act of collective human imagining). She observes that this reciprocation is almost always magnified. 

This is where the coat and its relation to the poem, comes into her argument.

She asks us to consider a coat made by a woman called Mildred Keats: she spends 2 weeks making the coat, but wears it for 20 years (here is the magnification effect of the artefact as lever). The 2 weeks of physical discomfort while she sews the coat are repaid many times by the warmth and mobility it provides her, thus freeing up her awareness of her body and its needs so that she can work on other aspects of world-making.

Similarly, John Keats writes a poem. He projects his own private thoughts and emotions into the poem (if inevitably imprinted by the discursive context in which he writes); it is printed, circulated, and now exists in the world of material objects for us to read. Perhaps it takes him 3 hours to write “Ode to a Nightingale.” It is still with us almost 200 years later. Each time it is read, “its power now moves back from the object realm to the human realm where sentience itself is remade” (p.307). We breath into his words, give them life; and they work on us too, reworking our consciousness.

This is a modest claim, then, for poems as artefact-levers, like coats, which are projected out into the world, and then return, magnified, modifying consciousness through time.

the DNA of Shakespeare’s Sonnets

January 25, 2013 § Leave a comment

“TAGATGTGTACAGACTACGC…..”   (Thou art more lovely and more temperate...)

An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.

I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.”  Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.

So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.

This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).

Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.

Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.

The earliest forms of poetry also carried practical information—poems do things:  Hesiod’s Works and Days;  perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.

And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.

The Guardian article explains how the encoding takes place:

“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”

This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.

Then the DNA is stored in a dry, cool, dark place.

A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.

But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate.  Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…”  Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved  in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.

In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.

Where Am I?

You are currently browsing the the use of poetry category at kim trainor.